scientists are saying they are finding random snippets of genetic code in the shots. Imagine this horror story.
Within the vax injectable genetic drug the manufacturer inserts a number of random codes. ATCAGTCAGGGTGAACTGGGTGG. CCATGGGTACTGATCTAGGCATTGATCTA. ETC…(etc is not a gene code by the way) just trying to make you smile.
At a future date they want to trigger another pandemic, you know drive the share price.
An incident is promoted by media, WHO/Gates or WHOmever. This time the dreaded ATCAGTCAGGGTGAACTGGGTGG is the terrible code phrase. All are on high alert set your VCR for above mentioned code sequence. If this is found in the test then we can say a positive result. Naturally it will be found we put it there.
Oh my goodness a new pandemic, different codes for different continents/countries, you know just for varietyorganized by lot number, do we need a libarian?.
Goodness new lockdowns, new/old vaccines. Hold on Hold on we don’t even need a new vax. Its just random code we installed in the previous shot. A three dressed up as a nine you might say. Just add water to the old vax, instant potatoes so to speak(thats the proper spelling Clinton Foundation) more deaths from social isolation, more profits, this years lambourgini(?).
Great Jimminy Cricket zippidy do da zippidy yay, what a wonderful day.
Impossible,,hmmmmm injecting kids with a pseudo vax that can have serious outcomes including death,,,,now thats impossible! These guys are peeing me off.
Did I say VCR meant to say PCR but it really is a horror movie. ok ok stand up aint my thing.
I have a screen writer friend maybe a movie here,,, we can all star as the good guys you know the natural human immune system, I call T Cell.
IVERMECTIN/HYDROXY work, we knew, the WHO knew, when did they know, who suppressed it.
Shawn663